This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00007828


Marker Name:  ILSTS087 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: AGCAGACATGATGACTCAGC
Primer: CTGCCTCTTTTCTTGAGAGC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00001653
has an Associated Sequence: Local Sequence ID: ARKFSQ00004497

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 6 Cow
chromosome 6
1141.000 1141.000 1141.000
ENSEMBL54 Btau_4.0 Cow Assembly: 6 Cow
chromosome 6
88984430.000 88984490.500 88984551.000
ENSEMBL66 UMD3.1 Cow Assembly: 6 Cow
chromosome 6
87839388.000 87839448.500 87839509.000
IBRP97 (A): 6 Cow
chromosome 6
109.000 109.000 109.000
Itoh, Tomohito et al. 2005: 6 Cow
chromosome 6
1010.890 1010.890 1010.890
MARC2004 (A): 6 Cow
chromosome 6
89.738 89.738 89.738
MARC97 (A): 6 Cow
chromosome 6
83.000 83.000 83.000
Mckay S.D. et al 2007: 6 Cow
chromosome 6
1738.900 1738.900 1738.900
Snelling, W et al. 2006 (Composite): 6 Cow
chromosome 6
87.600 87.600 89.900


© The Roslin Institute 2007-2012, all rights reserved