This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00007672


Marker Name:  IDVGA35 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: AAGTGCCATCACCTCCCCATTC
Primer: CACCTGCTCTTGACCCCTAAAAA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00004404

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL54 Btau_4.0 Cow Assembly: 3 Cow
chromosome 3
105272129.000 105272240.000 105272351.000
ENSEMBL66 UMD3.1 Cow Assembly: 3 Cow
chromosome 3
98955095.000 98955206.000 98955317.000
IBRP97 (A): 3 Cow
chromosome 3
158.000 158.000 158.000
MARC97 (A): 3 Cow
chromosome 3
102.900 102.900 102.900


© The Roslin Institute 2007-2012, all rights reserved