This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00007366


Marker Name:  BP2 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: GAGAAGGGAAGACATTACGGG
Primer: CTCTGAGCAGGCAGTGTTTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AAFC02027763
has an Associated Sequence: Local Sequence ID: ARKFSQ00004294

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
645.500 645.500 645.500
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
20492732.000 20492909.000 20493086.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
19851785.000 19851962.000 19852139.000
ILTXRH2004: 8_A Cow
chromosome 8
97.700 97.700 97.700
ILTXRH2005: 8 Cow
chromosome 8
204.000 204.000 204.000
Itoh, Tomohito et al. 2005: 8 Cow
chromosome 8
148.470 148.470 148.470
MARC2004 (A): 8 Cow
chromosome 8
30.517 30.517 30.517
MARC97 (A): 8 Cow
chromosome 8
26.300 26.300 26.300
Mckay S.D. et al 2007: 8 Cow
chromosome 8
764.500 764.500 764.500
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
23.600 23.600 23.600


© The Roslin Institute 2007-2012, all rights reserved