This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00007340


Marker Name:  BMS887 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: AAGCTAACTGATATTCTGCCACA
Primer: TTCCCTCTCTTCCCTCTCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18577
has an Associated Sequence: Local Sequence ID: ARKFSQ00004273
has an Associated Sequence: Local Sequence ID: ARKFSQ00003288

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
1707.900 1707.900 1707.900
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
65935084.000 65935158.500 65935233.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
63582133.000 63582207.000 63582281.000
Itoh, Tomohito et al. 2005: 8 Cow
chromosome 8
353.570 353.570 353.570
MARC2004 (A): 8 Cow
chromosome 8
68.450 68.450 68.450
MARC97 (A): 8 Cow
chromosome 8
60.600 60.600 60.600
Mckay S.D. et al 2007: 8 Cow
chromosome 8
2176.800 2176.800 2176.800
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
69.000 69.000 69.000


© The Roslin Institute 2007-2012, all rights reserved