This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00007248


Marker Name:  BMS47 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: CAGAGAGCGTCTGTGGAGG
Primer: TCTTGTCTGGCTGGATGATG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00004186
has an Associated Sequence: Local Sequence ID: ARKFSQ00000285

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 9 Cow
chromosome 9
219.600 219.600 219.600
ENSEMBL54 Btau_4.0 Cow Assembly: 9 Cow
chromosome 9
8255279.000 8255348.000 8255417.000
ENSEMBL66 UMD3.1 Cow Assembly: 9 Cow
chromosome 9
9141283.000 9141352.000 9141421.000
ILTXRH2004: 9_A Cow
chromosome 9
45.150 45.150 45.150
ILTXRH2005: 9 Cow
chromosome 9
49.000 49.000 49.000
Itoh, Tomohito et al. 2005: 9 Cow
chromosome 9
140.670 140.670 140.670
MARC2004 (A): 9 Cow
chromosome 9
9.653 9.653 9.653
MARC97 (A): 9 Cow
chromosome 9
4.900 4.900 4.900
Mckay S.D. et al 2007: 9 Cow
chromosome 9
328.300 328.300 328.300
Snelling, W et al. 2006 (Composite): 9 Cow
chromosome 9
8.900 8.900 8.900


© The Roslin Institute 2007-2012, all rights reserved