This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00007135


Marker Name:  BMS2629 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: TCCCACCCCTGATTATTGAC
Primer: TCTTCAGCATCTCATTTGTGTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G19003
has an Associated Sequence: Local Sequence ID: ARKFSQ00004070
has an Associated Sequence: Local Sequence ID: ARKFSQ00002951

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
2380.500 2380.500 2380.500
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
115008873.000 115008946.000 115009019.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
111408247.000 111408320.000 111408393.000
ILTXRH2004: 8_E Cow
chromosome 8
45.100 45.100 45.100
ILTXRH2005: 8 Cow
chromosome 8
1202.000 1202.000 1202.000
Itoh, Tomohito et al. 2005: 8 Cow
chromosome 8
576.960 576.960 576.960
MARC2004 (A): 8 Cow
chromosome 8
124.705 124.705 124.705
MARC97 (A): 8 Cow
chromosome 8
116.300 116.300 116.300
Mckay S.D. et al 2007: 8 Cow
chromosome 8
3334.300 3334.300 3334.300
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
130.400 130.400 130.400


© The Roslin Institute 2007-2012, all rights reserved