This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00007083


Marker Name:  BMS2196 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: CCTTTTGTCATTTAACCTTCCA
Primer: TAAACAAATCAACCAAACAAGAAA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008111
has an Associated Sequence: Local Sequence ID: ARKFSQ00008112
has an Associated Sequence: Local Sequence ID: ARKFSQ00001708

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
2010.200 2010.200 2010.200
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
87670696.000 87670753.500 87670811.000
ENSEMBL54 Btau_4.0 Cow Assembly: Un.004.3566 Cow
chromosome
10647.000 10704.500 10762.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
84858039.000 84858096.500 84858154.000
Itoh, Tomohito et al. 2005: 8 Cow
chromosome 8
505.570 505.570 505.570
MARC2004 (A): 8 Cow
chromosome 8
89.063 89.063 89.063
MARC97 (A): 8 Cow
chromosome 8
80.700 80.700 80.700
Mckay S.D. et al 2007: 8 Cow
chromosome 8
2727.800 2727.800 2727.800
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
97.800 98.500 100.500


© The Roslin Institute 2007-2012, all rights reserved