This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00007064


Marker Name:  BMS2072 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: TGTTCAGTGCTTGTCTTAGCTG
Primer: TCTTCAAAGCCATCAATCATC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00001629
has an Associated Sequence: Local Sequence ID: ARKFSQ00008087

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
1614.200 1614.200 1614.200
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
63660772.000 63660853.000 63660934.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
61295477.000 61295558.000 61295639.000
ILTXRH2004: 8_B Cow
chromosome 8
140.210 140.210 140.210
ILTXRH2005: 8 Cow
chromosome 8
621.000 621.000 621.000
Itoh, Tomohito et al. 2005: 8 Cow
chromosome 8
340.670 340.670 340.670
MARC2004 (A): 8 Cow
chromosome 8
66.033 66.033 66.033
MARC97 (A): 8 Cow
chromosome 8
58.800 58.800 58.800
Mckay S.D. et al 2007: 8 Cow
chromosome 8
2108.000 2108.000 2108.000
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
59.100 59.100 68.700


© The Roslin Institute 2007-2012, all rights reserved