This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00007034


Marker Name:  BMS1864 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: ATATAGGGCAGCATTCTTTTCA
Primer: TATAATGCCCTCCAAGTCCA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00007916
has an Associated Sequence: Sequence Genbank ID: G18610

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
0.000 0.000 0.000
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
3138003.000 3138076.500 3138150.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
3242181.000 3242254.500 3242328.000
ILTXRH2004: 8_A Cow
chromosome 8
0.000 0.000 0.000
ILTXRH2005: 8 Cow
chromosome 8
27.000 27.000 27.000
Itoh, Tomohito et al. 2005: 8 Cow
chromosome 8
38.560 38.560 38.560
MARC2004 (A): 8 Cow
chromosome 8
2.684 2.684 2.684
MARC97 (A): 8 Cow
chromosome 8
0.000 0.000 0.000
Mckay S.D. et al 2007: 8 Cow
chromosome 8
154.800 154.800 154.800
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
3.800 3.800 3.800


© The Roslin Institute 2007-2012, all rights reserved