This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00006983


Marker Name:  BMS1341 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: CCTACCTACTGCACAGTTTTGC
Primer: CTCCCATATAAGTTACCCACCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00007355
has an Associated Sequence: Sequence Genbank ID: G18660
has an Associated Sequence: Local Sequence ID: ARKFSQ00002313

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
1180.800 1180.800 1180.800
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
52945302.000 52945362.500 52945423.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
50899485.000 50899545.500 50899606.000
Itoh, Tomohito et al. 2005: 8 Cow
chromosome 8
293.930 293.930 293.930
MARC2004 (A): 8 Cow
chromosome 8
54.646 54.646 54.646
MARC97 (A): 8 Cow
chromosome 8
51.400 51.400 51.400
Mckay S.D. et al 2007: 8 Cow
chromosome 8
1618.600 1618.600 1618.600
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
51.700 53.100 60.600


© The Roslin Institute 2007-2012, all rights reserved