This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00006826


Marker Name:  BM711 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: CAGCATCAGCAACTAACATAGG
Primer: TGGACCATGAGGGAAGTCTC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00005809
has an Associated Sequence: Local Sequence ID: ARKFSQ00005808

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
2220.700 2220.700 2220.700
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
92684519.000 92684607.000 92684695.000
ENSEMBL54 Btau_4.0 Cow Assembly: Un.004.4051 Cow
chromosome
858.000 943.000 1028.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
89588554.000 89588635.000 89588716.000
ILTXRH2004: 8_D Cow
chromosome 8
61.630 61.630 61.630
ILTXRH2005: 8 Cow
chromosome 8
1055.000 1055.000 1055.000
IRRF95 (M): 8 Cow
chromosome 8
0.000 0.000 0.000
Itoh, Tomohito et al. 2005: 8 Cow
chromosome 8
515.350 515.350 515.350
MARC2004 (A): 8 Cow
chromosome 8
92.729 92.729 92.729
MARC97 (A): 8 Cow
chromosome 8
83.600 83.600 83.600
Mckay S.D. et al 2007: 8 Cow
chromosome 8
2854.700 2854.700 2854.700
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
101.700 101.700 101.700


© The Roslin Institute 2007-2012, all rights reserved