This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00006785


Marker Name:  BM4528 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: CAGAATCCATACACATGTCAACA
Primer: AGGAACAGGTATAGGAATATTGGA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00002248
has an Associated Sequence: Sequence Genbank ID: G19091
has an Associated Sequence: Local Sequence ID: ARKFSQ00005371

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 6 Cow
chromosome 6
718.600 718.600 718.600
ENSEMBL54 Btau_4.0 Cow Assembly: 6 Cow
chromosome 6
65856391.000 65856511.500 65856632.000
ENSEMBL66 UMD3.1 Cow Assembly: 6 Cow
chromosome 6
64727183.000 64727303.500 64727424.000
IBRP97 (A): 6 Cow
chromosome 6
91.000 91.000 91.000
ILTXRH2004: 6_C Cow
chromosome 6
84.750 84.750 84.750
ILTXRH2005: 6 Cow
chromosome 6
660.000 660.000 660.000
Itoh, Tomohito et al. 2005: 6 Cow
chromosome 6
806.050 806.050 806.050
MARC2004 (A): 6 Cow
chromosome 6
70.741 70.741 70.741
MARC97 (A): 6 Cow
chromosome 6
68.100 68.100 68.100
Mckay S.D. et al 2007: 6 Cow
chromosome 6
1419.400 1419.400 1419.400
Snelling, W et al. 2006 (Composite): 6 Cow
chromosome 6
66.400 67.400 67.400


© The Roslin Institute 2007-2012, all rights reserved