This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00006773


Marker Name:  BM4208 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: TCAGTACACTGGCCACCATG
Primer: CACTGCATGCTTTTCCAAAC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00005210
has an Associated Sequence: Local Sequence ID: ARKFSQ00000716

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 9 Cow
chromosome 9
2363.900 2363.900 2363.900
ENSEMBL54 Btau_4.0 Cow Assembly: 9 Cow
chromosome 9
88747991.000 88748071.000 88748151.000
ENSEMBL66 UMD3.1 Cow Assembly: 9 Cow
chromosome 9
86728700.000 86728780.000 86728860.000
ILTXRH2004: 9_B Cow
chromosome 9
46.320 46.320 46.320
ILTXRH2005: 9 Cow
chromosome 9
606.000 606.000 606.000
IRRF95 (M): 9 Cow
chromosome 9
44.000 44.000 44.000
Itoh, Tomohito et al. 2005: 9 Cow
chromosome 9
818.870 818.870 818.870
MARC2004 (A): 9 Cow
chromosome 9
90.690 90.690 90.690
MARC97 (A): 9 Cow
chromosome 9
84.600 84.600 84.600
Mckay S.D. et al 2007: 9 Cow
chromosome 9
2696.600 2696.600 2696.600
Snelling, W et al. 2006 (Composite): 9 Cow
chromosome 9
90.600 90.600 90.900


© The Roslin Institute 2007-2012, all rights reserved