This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00006725


Marker Name:  BM2304 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: AGCAAGTGAACTGAACTGATTG
Primer: TTCCTGCTCTTCTACTCTCTGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18592
has an Associated Sequence: Local Sequence ID: ARKFSQ00000460
has an Associated Sequence: Local Sequence ID: ARKFSQ00004711

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
1955.300 1955.300 1955.300
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
83490963.000 83491036.500 83491110.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
80738418.000 80738491.500 80738565.000
Itoh, Tomohito et al. 2005: 8 Cow
chromosome 8
467.850 467.850 467.850
MARC2004 (A): 8 Cow
chromosome 8
84.716 84.716 84.716
MARC97 (A): 8 Cow
chromosome 8
76.700 76.700 76.700
Mckay S.D. et al 2007: 8 Cow
chromosome 8
2587.100 2587.100 2587.100
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
81.500 81.500 81.500


© The Roslin Institute 2007-2012, all rights reserved