This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00006681


Marker Name:  BM1227 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: CACCAGTGATATTGGCTTATGG
Primer: GGAAGAAACACTTCCAAACCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00004265
has an Associated Sequence: Local Sequence ID: ARKFSQ00004264

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 9 Cow
chromosome 9
496.300 496.300 496.300
ENSEMBL54 Btau_4.0 Cow Assembly: 9 Cow
chromosome 9
17864617.000 17864674.000 17864731.000
ENSEMBL54 Btau_4.0 Cow Assembly: Un.004.4577 Cow
chromosome
3357.000 3414.000 3471.000
ENSEMBL66 UMD3.1 Cow Assembly: 9 Cow
chromosome 9
18180000.000 18180057.000 18180114.000
ILTXRH2004: 9_A Cow
chromosome 9
68.980 68.980 68.980
ILTXRH2005: 9 Cow
chromosome 9
125.000 125.000 125.000
Itoh, Tomohito et al. 2005: 9 Cow
chromosome 9
269.070 269.070 269.070
MARC2004 (A): 9 Cow
chromosome 9
24.139 24.139 24.139
MARC97 (A): 9 Cow
chromosome 9
19.100 19.100 19.100
Mckay S.D. et al 2007: 9 Cow
chromosome 9
472.500 472.500 472.500
Snelling, W et al. 2006 (Composite): 9 Cow
chromosome 9
23.900 23.900 25.200


© The Roslin Institute 2007-2012, all rights reserved