This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00006667


Marker Name:  BL41 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: CCTCTGCCATCTTTATTCCG
Primer: AAGATCAACTTATTCCTCACAGTGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AAFC02077228
has an Associated Sequence: Local Sequence ID: ARKFSQ00001273
has an Associated Sequence: Local Sequence ID: ARKFSQ00004168

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 3 Cow
chromosome 3
1604.200 1604.200 1604.200
ENSEMBL54 Btau_4.0 Cow Assembly: 3 Cow
chromosome 3
30143222.000 30143345.500 30143469.000
ENSEMBL66 UMD3.1 Cow Assembly: 3 Cow
chromosome 3
27776034.000 27776157.500 27776281.000
IBRP97 (A): 3 Cow
chromosome 3
50.000 50.000 50.000
ILTXRH2004: 3_A Cow
chromosome 3
96.710 96.710 96.710
Itoh, Tomohito et al. 2005: 3 Cow
chromosome 3
292.440 292.440 292.440
MARC2004 (A): 3 Cow
chromosome 3
43.292 43.292 43.292
MARC97 (A): 3 Cow
chromosome 3
45.200 45.200 45.200
Mckay S.D. et al 2007: 3 Cow
chromosome 3
1202.800 1202.800 1202.800
Snelling, W et al. 2006 (Composite): 3 Cow
chromosome 3
43.500 43.500 43.500


© The Roslin Institute 2007-2012, all rights reserved