This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00006506


Marker Name:  TIMP3 
Species:  Chicken
Marker Type:  PCR-RFLP
Publication ID: 7910177

PCR Primers

Primer: AACTGGAGGTCAACAAATACCAG
Primer: AGGCCAGTGTAAACCTTCCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00004032
has an Associated Sequence: Sequence Genbank ID: M94531

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
158.000 158.000 158.000
East Lansing (M): 1 Chicken
chromosome 1
162.800 162.800 162.800
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
55132962.000 55133326.500 55133691.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
53059637.000 53060001.500 53060366.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
52941627.000 52941991.500 52942356.000


© The Roslin Institute 2007-2012, all rights reserved