This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00006423


Marker Name:  ROS0262 
Species:  Chicken
Marker Type:  SSCP
Publication ID: 10645958

PCR Primers

Primer: CTGCTGAACCATCAGACACG
Primer: ATTCCTTAAGCCAGCACAGC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00004022

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
565.000 565.000 565.000
Consensus 2005 (A): 1 Chicken
chromosome 1
101.000 565.000 141.000
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
199344667.000 199344792.500 199344918.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
193634932.000 193635057.500 193635183.000


© The Roslin Institute 2007-2012, all rights reserved