This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00006385


Marker Name:  ROS0078 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: AGGGCTTGCACTGTACTTAGC
Primer: CAGAACGTGAGCAAATTCATG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003999

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 9 Chicken
chromosome 9
0.000 0.000 0.000
Consensus 2000 (A): 9 Chicken
chromosome 9
0.000 0.000 0.000
Consensus 2005 (A): 9 Chicken
chromosome 9
-1.000 0.000 1.000
East Lansing (M): 9 Chicken
chromosome 9
6.000 6.000 6.000
ENSEMBL53 WASHUC2 Chicken Assembly: 9 Chicken
chromosome 9
1913910.000 1914000.000 1914090.000
ENSEMBL71 Galgal4 Chick Assembly: 9 Chicken
chromosome 9
486684.000 486774.000 486864.000
Ikeobi, C.O.N. et al . 2002 (A): 9 Chicken
chromosome 9
0.000 0.000 0.000
Ikeobi, C.O.N. et al . 2004 (A): 9 Chicken
chromosome 9
0.000 0.000 0.000
Sewalem, A. et al . 2002 (A): 9 Chicken
chromosome 9
0.000 0.000 0.000
Wageningen (A): 9 Chicken
chromosome 9
0.000 0.000 0.000
Wageningen (F): 9 Chicken
chromosome 9
0.000 0.000 0.000
Wageningen (M): 9 Chicken
chromosome 9
0.000 0.000 0.000


© The Roslin Institute 2007-2012, all rights reserved