This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00006358


Marker Name:  ROS0030 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: CGGAGAGCATGGTTTCAAGT
Primer: CTCTGTGAGCTCCCCATCTC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003993

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL53 WASHUC2 Chicken Assembly: 9 Chicken
chromosome 9
23770679.000 23770802.000 23770925.000
ENSEMBL71 Galgal4 Chick Assembly: 9 Chicken
chromosome 9
21681024.000 21681147.000 21681270.000
Wageningen (A): 9 Chicken
chromosome 9
98.300 98.300 98.300
Wageningen (F): 9 Chicken
chromosome 9
99.800 99.800 99.800
Wageningen (M): 9 Chicken
chromosome 9
97.000 97.000 97.000


© The Roslin Institute 2007-2012, all rights reserved