This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00006352


Marker Name:  ROS0025 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: AGATTGCTGGGGGAAAAAGT
Primer: ACTGAAAACCTGAACAGAAGGC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003990

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
East Lansing (M): 1 Chicken
chromosome 1
472.420 472.420 472.420
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
182910620.000 182910721.000 182910822.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
177853193.000 177853294.000 177853395.000
Wageningen (A): 1 Chicken
chromosome 1
481.700 481.700 481.700
Wageningen (F): 1 Chicken
chromosome 1
486.000 486.000 486.000
Wageningen (M): 1 Chicken
chromosome 1
498.800 498.800 498.800


© The Roslin Institute 2007-2012, all rights reserved