This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00006341


Marker Name:  ROS0019 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: ATGTACAGGTTCCAGTGTCCG
Primer: CCAGTTCRTACAACCTTGAGTTGG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003984

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 7 Chicken
chromosome 7
43.810 43.810 43.810
Consensus 2000 (A): 7 Chicken
chromosome 7
64.000 64.000 64.000
Consensus 2005 (A): 7 Chicken
chromosome 7
100.000 101.000 102.000
East Lansing (M): 7 Chicken
chromosome 7
42.950 42.950 42.950
ENSEMBL53 WASHUC2 Chicken Assembly: 7 Chicken
chromosome 7
28120850.000 28120908.500 28120967.000
ENSEMBL71 Galgal4 Chick Assembly: 7 Chicken
chromosome 7
26039957.000 26040015.500 26040074.000
Ikeobi, C.O.N. et al . 2002 (A): 7 Chicken
chromosome 7
101.000 101.000 101.000
Ikeobi, C.O.N. et al . 2004 (A): 7 Chicken
chromosome 7
101.000 101.000 101.000
Sewalem, A. et al . 2002 (A): 7 Chicken
chromosome 7
101.000 101.000 101.000
Wageningen (A): 7 Chicken
chromosome 7
69.500 69.500 69.500
Wageningen (F): 7 Chicken
chromosome 7
69.700 69.700 69.700
Wageningen (M): 7 Chicken
chromosome 7
66.400 66.400 66.400


© The Roslin Institute 2007-2012, all rights reserved