This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00006337


Marker Name:  ROS0017 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: TCTGGRRGGCRAGAATGTG
Primer: GCAAGCAGGCTGTGTTTCTG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003982

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Ben-Avraham, D. et al 2006 (M): Z Chicken
chromosome Z
139.310 139.310 139.310
Consensus 2000 (A): Z Chicken
chromosome Z
112.000 112.000 112.000
Consensus 2005 (A): Z Chicken
chromosome Z
111.000 112.000 113.000
East Lansing (M): Z Chicken
chromosome Z
139.310 139.310 139.310
ENSEMBL53 WASHUC2 Chicken Assembly: Z Chicken
chromosome Z
45473326.000 45473395.000 45473464.000
ENSEMBL71 Galgal4 Chick Assembly: Z Chicken
chromosome Z
46134844.000 46134913.000 46134982.000
Wageningen (A): Z Chicken
chromosome Z
114.000 114.000 114.000
Wageningen (M): Z Chicken
chromosome Z
114.000 114.000 114.000


© The Roslin Institute 2007-2012, all rights reserved