This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00006290


Marker Name:  PGR 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 1353476

PCR Primers

Primer: AACACACAGAGAGGTGCCTATG
Primer: ATAGGCTGCTTTGGAAGTCTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: J05240
has an Associated Sequence: Local Sequence ID: ARKFSQ00003971

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
578.230 578.230 578.230
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
187456295.000 187456446.000 187456597.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
182428233.000 182428384.500 182428536.000


© The Roslin Institute 2007-2012, all rights reserved