This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00006022


Marker Name:  MCW0297 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: TGCCAAACATGACCTCCAGTC
Primer: ACTTCACTGCAGGGTGGTGAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G32054
has an Associated Sequence: Local Sequence ID: ARKFSQ00003943

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
162.000 162.000 162.000
Consensus 2005 (A): 1 Chicken
chromosome 1
161.000 162.000 163.000
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
53798691.000 53798834.000 53798977.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
51632067.000 51632214.000 51632361.000
Jennen et al. 2005 (A): 1 Chicken
chromosome 1
16.300 16.300 16.300
Wageningen (A): 1 Chicken
chromosome 1
129.200 129.200 129.200
Wageningen (F): 1 Chicken
chromosome 1
118.000 118.000 118.000
Wageningen (M): 1 Chicken
chromosome 1
140.500 140.500 140.500


© The Roslin Institute 2007-2012, all rights reserved