This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005999


Marker Name:  MCW0273E 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: TGTTATGCCATTGCTTTTAG
Primer: CAGCACCCACATCAAGATCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF030582
has an Associated Sequence: Local Sequence ID: ARKFSQ00003923

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
132660888.000 132660974.000 132661060.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
127918141.000 127918227.000 127918313.000
Wageningen (A): 1 Chicken
chromosome 1
357.200 357.200 357.200
Wageningen (F): 1 Chicken
chromosome 1
334.300 334.300 334.300
Wageningen (M): 1 Chicken
chromosome 1
383.500 383.500 383.500


© The Roslin Institute 2007-2012, all rights reserved