This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005980


Marker Name:  MCW0254 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: GAACCAATGAAAGCGAGATGC
Primer: GTGTTCAAAATGCTGAGAAGTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G32022

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
85.000 85.000 85.000
Consensus 2005 (A): 1 Chicken
chromosome 1
84.000 85.000 86.000
Jacobsson et al 2004 (A): 1 Chicken
chromosome 1
56.500 56.500 56.500
Wageningen (A): 1 Chicken
chromosome 1
57.100 57.100 57.100
Wageningen (F): 1 Chicken
chromosome 1
54.100 54.100 54.100
Wageningen (M): 1 Chicken
chromosome 1
63.800 63.800 63.800


© The Roslin Institute 2007-2012, all rights reserved