This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005976


Marker Name:  MCW0250 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: CAGAATTTAGAGACTGTCTAC
Primer: ATACGGTAGCTCTGTTGCAAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G32018
has an Associated Sequence: Local Sequence ID: ARKFSQ00003909

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Carlborg, Orjan. et al . 2003 (A): 6 Chicken
chromosome 6
81.600 81.600 81.600
Consensus 2000 (A): 6 Chicken
chromosome 6
87.000 87.000 87.000
Consensus 2005 (A): 6 Chicken
chromosome 6
58.000 59.000 60.000
ENSEMBL53 WASHUC2 Chicken Assembly: 6 Chicken
chromosome 6
16580914.000 16581026.500 16581139.000
ENSEMBL71 Galgal4 Chick Assembly: 6 Chicken
chromosome 6
15057303.000 15057415.500 15057528.000
Jacobsson et al 2004 (A): 6 Chicken
chromosome 6
26.500 26.500 26.500
Kerje et al. 2003a (A): 6 Chicken
chromosome 6
81.600 81.600 81.600
Kerje, S et al. 2003 (A): 6 Chicken
chromosome 6
81.600 81.600 81.600
Wageningen (A): 6 Chicken
chromosome 6
82.000 82.000 82.000
Wageningen (F): 6 Chicken
chromosome 6
81.200 81.200 81.200
Wageningen (M): 6 Chicken
chromosome 6
79.300 79.300 79.300


© The Roslin Institute 2007-2012, all rights reserved