This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005967


Marker Name:  MCW0241 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: AACCAGTTTGTTAACATCAGC
Primer: ATTGGAGTTGGTACCATACTC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003903
has an Associated Sequence: Sequence Genbank ID: G32010

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL53 WASHUC2 Chicken Assembly: Z Chicken
chromosome Z
34264059.000 34264194.500 34264330.000
ENSEMBL71 Galgal4 Chick Assembly: Z Chicken
chromosome Z
34454907.000 34455042.500 34455178.000
Kerje, S et al. 2003 (A): Z Chicken
chromosome Z
50.500 50.500 50.500
Wageningen (A): Z Chicken
chromosome Z
100.800 100.800 100.800
Wageningen (M): Z Chicken
chromosome Z
100.800 100.800 100.800


© The Roslin Institute 2007-2012, all rights reserved