This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005958


Marker Name:  MCW0231 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: CTTTCTGAAATTCACAAATGTAG
Primer: ATTCCTTTCTGTGCTTCTCAC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003896
has an Associated Sequence: Sequence Genbank ID: G32002

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Buitenhuis et al. 2003a (A): 15 Chicken
chromosome 15
31.000 31.000 31.000
Consensus 2000 (A): 15 Chicken
chromosome 15
31.000 31.000 31.000
Consensus 2005 (A): 15 Chicken
chromosome 15
30.000 31.000 32.000
ENSEMBL53 WASHUC2 Chicken Assembly: 15 Chicken
chromosome 15
7928397.000 7928529.500 7928662.000
ENSEMBL71 Galgal4 Chick Assembly: 15 Chicken
chromosome 15
7684634.000 7684766.500 7684899.000
Jennen et al. 2004 (A): 15 Chicken
chromosome 15
31.000 31.000 31.000
Wageningen (A): 15 Chicken
chromosome 15
19.500 19.500 19.500
Wageningen (F): 15 Chicken
chromosome 15
19.600 19.600 19.600
Wageningen (M): 15 Chicken
chromosome 15
18.700 18.700 18.700


© The Roslin Institute 2007-2012, all rights reserved