This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005953


Marker Name:  MCW0226 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: ACTTATCTGGCTTGCTCTCAG
Primer: GTCTCTCXTAACCATCCTAAGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G31998

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 15 Chicken
chromosome 15
8.000 8.000 8.000
Consensus 2005 (A): 15 Chicken
chromosome 15
7.000 8.000 9.000
Jennen et al. 2004 (A): 15 Chicken
chromosome 15
8.000 8.000 8.000
Wageningen (A): 15 Chicken
chromosome 15
41.800 41.800 41.800
Wageningen (F): 15 Chicken
chromosome 15
40.600 40.600 40.600
Wageningen (M): 15 Chicken
chromosome 15
42.300 42.300 42.300


© The Roslin Institute 2007-2012, all rights reserved