This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005942


Marker Name:  MCW0213 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: CTGTTCACTTTAAGGACATGG
Primer: GACAAGTCAACAACTTGCCAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G31990
has an Associated Sequence: Local Sequence ID: ARKFSQ00003884

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Carlborg, Orjan. et al . 2003 (A): 13 Chicken
chromosome 13
26.000 26.000 26.000
Consensus 2000 (A): 13 Chicken
chromosome 13
52.000 52.000 52.000
Consensus 2005 (A): 13 Chicken
chromosome 13
21.000 22.000 23.000
ENSEMBL53 WASHUC2 Chicken Assembly: 13 Chicken
chromosome 13
10363506.000 10363657.500 10363809.000
ENSEMBL71 Galgal4 Chick Assembly: 13 Chicken
chromosome 13
9607064.000 9607218.500 9607373.000
Jacobsson et al 2004 (A): 13 Chicken
chromosome 13
3.200 3.200 3.200
Jennen et al. 2004 (A): 13 Chicken
chromosome 13
22.000 22.000 22.000
Kerje et al. 2003a (A): 13 Chicken
chromosome 13
26.000 26.000 26.000
Kerje, S et al. 2003 (A): 13 Chicken
chromosome 13
26.000 26.000 26.000
Wageningen (A): 13 Chicken
chromosome 13
50.800 50.800 50.800
Wageningen (F): 13 Chicken
chromosome 13
46.800 46.800 46.800
Wageningen (M): 13 Chicken
chromosome 13
55.200 55.200 55.200


© The Roslin Institute 2007-2012, all rights reserved