This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005928


Marker Name:  MCW0200 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: GAGACATTGCAAATACTCAGC
Primer: TAGTCAGGGAGTTCAGGAAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G31982
has an Associated Sequence: Local Sequence ID: ARKFSQ00003873

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
330.000 330.000 330.000
Consensus 2005 (A): 1 Chicken
chromosome 1
329.000 330.000 331.000
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
111258815.000 111258933.000 111259051.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
107173608.000 107173726.000 107173844.000
Jacobsson et al 2004 (A): 1 Chicken
chromosome 1
290.600 290.600 290.600
Tilquin et al. 2005 (A): 1 Chicken
chromosome 1
330.000 330.000 330.000
Wageningen (A): 1 Chicken
chromosome 1
300.600 300.600 300.600
Wageningen (F): 1 Chicken
chromosome 1
282.900 282.900 282.900
Wageningen (M): 1 Chicken
chromosome 1
320.500 320.500 320.500
Wardecka et al. 2002 (F): 1 Chicken
chromosome 1
100.000 100.000 100.000


© The Roslin Institute 2007-2012, all rights reserved