This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005924


Marker Name:  MCW0195 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: TCTGAAGTAGAGTAAAGGCAG
Primer: GAATAGCACAGTGTCTGCTGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G31978
has an Associated Sequence: Local Sequence ID: ARKFSQ00003871

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
302.000 302.000 302.000
Consensus 2005 (A): 1 Chicken
chromosome 1
301.000 302.000 303.000
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
100755844.000 100755947.000 100756050.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
96698739.000 96698842.000 96698945.000
Tilquin et al. 2005 (A): 1 Chicken
chromosome 1
302.000 302.000 302.000
Wageningen (A): 1 Chicken
chromosome 1
273.000 273.000 273.000
Wageningen (F): 1 Chicken
chromosome 1
258.600 258.600 258.600
Wageningen (M): 1 Chicken
chromosome 1
289.800 289.800 289.800


© The Roslin Institute 2007-2012, all rights reserved