This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005920


Marker Name:  MCW0190 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 1353476

PCR Primers

Primer: GTGATCATTTCTACATGCAG
Primer: ACAACAGAACTAAACAAATA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003867
has an Associated Sequence: Sequence Genbank ID: L48881

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 9 Chicken
chromosome 9
52.330 52.330 52.330
ENSEMBL53 WASHUC2 Chicken Assembly: 9 Chicken
chromosome 9
12930630.000 12930670.500 12930711.000
ENSEMBL71 Galgal4 Chick Assembly: 9 Chicken
chromosome 9
11320871.000 11320911.500 11320952.000


© The Roslin Institute 2007-2012, all rights reserved