This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005911


Marker Name:  MCW0181 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: GATCTCCAGAGGTCCTTTCC
Primer: GTGATGTTGAACACTGCAGTC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003863

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
457.000 457.000 457.000
Consensus 2005 (A): 1 Chicken
chromosome 1
456.000 457.000 458.000
East Lansing (M): 1 Chicken
chromosome 1
437.130 437.130 437.130
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
165563739.000 165563859.500 165563980.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
160636495.000 160636615.500 160636736.000
Wageningen (A): 1 Chicken
chromosome 1
430.700 430.700 430.700
Wageningen (F): 1 Chicken
chromosome 1
418.000 418.000 418.000
Wageningen (M): 1 Chicken
chromosome 1
452.100 452.100 452.100


© The Roslin Institute 2007-2012, all rights reserved