This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005898


Marker Name:  MCW0168 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: GATCAGATTTATTTCCCCTCA
Primer: CTGATTTCTAGAGCTGACTGA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003856

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
24.000 24.000 24.000
Consensus 2005 (A): 1 Chicken
chromosome 1
23.000 24.000 25.000
East Lansing (M): 1 Chicken
chromosome 1
22.350 22.350 22.350
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
2365050.000 2365105.000 2365160.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
2469611.000 2469666.000 2469721.000
Ikeobi, C.O.N. et al . 2002 (A): 1 Chicken
chromosome 1
0.000 0.000 0.000
Ikeobi, C.O.N. et al . 2004 (A): 1 Chicken
chromosome 1
0.000 0.000 0.000
Jacobsson et al 2004 (A): 1 Chicken
chromosome 1
0.000 0.000 0.000
Jennen et al. 2004 (A): 1 Chicken
chromosome 1
24.000 24.000 24.000
Sewalem, A. et al . 2002 (A): 1 Chicken
chromosome 1
0.000 0.000 0.000
Tilquin et al. 2005 (A): 1 Chicken
chromosome 1
24.000 24.000 24.000
Wageningen (A): 1 Chicken
chromosome 1
0.000 0.000 0.000
Wageningen (F): 1 Chicken
chromosome 1
0.000 0.000 0.000
Wageningen (M): 1 Chicken
chromosome 1
0.000 0.000 0.000


© The Roslin Institute 2007-2012, all rights reserved