This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005875


Marker Name:  MCW0145 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: ACTTTATTCTCCAAATTTGGCT
Primer: AAACACAATGGCAACGGAAAC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003839

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
524.240 524.240 524.240
Consensus 2000 (A): 1 Chicken
chromosome 1
455.000 455.000 455.000
Consensus 2005 (A): 1 Chicken
chromosome 1
454.000 455.000 456.000
East Lansing (M): 1 Chicken
chromosome 1
433.050 433.050 433.050
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
162032735.000 162032835.500 162032936.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
157114439.000 157114539.500 157114640.000
Wageningen (A): 1 Chicken
chromosome 1
429.400 429.400 429.400
Wageningen (F): 1 Chicken
chromosome 1
418.000 418.000 418.000
Wageningen (M): 1 Chicken
chromosome 1
449.600 449.600 449.600
Wardecka et al. 2002 (F): 1 Chicken
chromosome 1
267.700 267.700 267.700


© The Roslin Institute 2007-2012, all rights reserved