This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005866


Marker Name:  MCW0135 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: ATATGCTGCAGAGGGCAGTAG
Primer: CATGTTCTGCATTATTGCTCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003834

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Carlborg, Orjan. et al . 2003 (A): 9 Chicken
chromosome 9
16.800 16.800 16.800
Compton (F): 9 Chicken
chromosome 9
60.230 60.230 60.230
East Lansing (M): 9 Chicken
chromosome 9
44.540 44.540 44.540
ENSEMBL53 WASHUC2 Chicken Assembly: 9 Chicken
chromosome 9
13658592.000 13658665.000 13658738.000
ENSEMBL71 Galgal4 Chick Assembly: 9 Chicken
chromosome 9
12041995.000 12042068.000 12042141.000
Kerje, S et al. 2003 (A): 9 Chicken
chromosome 9
16.800 16.800 16.800
Wageningen (A): 9 Chicken
chromosome 9
40.500 40.500 40.500
Wageningen (F): 9 Chicken
chromosome 9
42.500 42.500 42.500
Wageningen (M): 9 Chicken
chromosome 9
38.500 38.500 38.500


© The Roslin Institute 2007-2012, all rights reserved