This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005865


Marker Name:  MCW0134 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: GGAGACTTCATTGTGTAGCAC
Primer: ACCAAAAGACTGGAGGTCAAC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003833

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 9 Chicken
chromosome 9
162.910 162.910 162.910
Consensus 2000 (A): 9 Chicken
chromosome 9
132.000 132.000 132.000
Consensus 2005 (A): 9 Chicken
chromosome 9
131.000 132.000 133.000
East Lansing (M): 9 Chicken
chromosome 9
79.260 79.260 79.260
ENSEMBL53 WASHUC2 Chicken Assembly: 9 Chicken
chromosome 9
24767004.000 24767142.000 24767280.000
ENSEMBL71 Galgal4 Chick Assembly: 9 Chicken
chromosome 9
22665529.000 22665667.000 22665805.000
Jacobsson et al 2004 (A): 9 Chicken
chromosome 9
79.100 79.100 79.100
Wageningen (A): 9 Chicken
chromosome 9
102.200 102.200 102.200
Wageningen (F): 9 Chicken
chromosome 9
102.400 102.400 102.400
Wageningen (M): 9 Chicken
chromosome 9
102.700 102.700 102.700


© The Roslin Institute 2007-2012, all rights reserved