This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005846


Marker Name:  MCW0115 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: ATACCAACATCTGCCTCTGAC
Primer: GCAGTGTGTCTGACTAGCTCT
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003818

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
584.260 584.260 584.260
Consensus 2000 (A): 1 Chicken
chromosome 1
518.000 518.000 518.000
Consensus 2005 (A): 1 Chicken
chromosome 1
517.000 518.000 519.000
East Lansing (M): 1 Chicken
chromosome 1
464.400 464.400 464.400
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
187224339.000 187224459.000 187224579.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
182196404.000 182196524.000 182196644.000
Tilquin et al. 2005 (A): 1 Chicken
chromosome 1
518.000 518.000 518.000
Wageningen (A): 1 Chicken
chromosome 1
492.800 492.800 492.800
Wageningen (F): 1 Chicken
chromosome 1
490.200 490.200 490.200
Wageningen (M): 1 Chicken
chromosome 1
510.900 510.900 510.900


© The Roslin Institute 2007-2012, all rights reserved