This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005843


Marker Name:  MCW0112 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: ATCTCTCTGCCCATGTTTCAG
Primer: GATCACTAAGGTCCCTTCAA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003815

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
184.520 184.520 184.520
Consensus 2000 (A): 1 Chicken
chromosome 1
205.000 205.000 205.000
Consensus 2005 (A): 1 Chicken
chromosome 1
204.000 205.000 206.000
East Lansing (M): 1 Chicken
chromosome 1
189.820 189.820 189.820
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
67128747.000 67128882.000 67129017.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
65124728.000 65124863.000 65124998.000
Wageningen (A): 1 Chicken
chromosome 1
172.100 172.100 172.100
Wageningen (F): 1 Chicken
chromosome 1
164.400 164.400 164.400
Wageningen (M): 1 Chicken
chromosome 1
182.200 182.200 182.200


© The Roslin Institute 2007-2012, all rights reserved