This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005842


Marker Name:  MCW0111 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: GCTCCATGTGAAGTGGTTTA
Primer: ATGTCCACTTGTCAATGATG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L48909
has an Associated Sequence: Local Sequence ID: ARKFSQ00003814

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
118.000 118.000 118.000
Consensus 2005 (A): 1 Chicken
chromosome 1
117.000 118.000 119.000
East Lansing (M): 1 Chicken
chromosome 1
106.600 106.600 106.600
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
40993590.000 40993642.500 40993695.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
39042200.000 39042252.500 39042305.000
Wageningen (A): 1 Chicken
chromosome 1
85.200 85.200 85.200
Wageningen (F): 1 Chicken
chromosome 1
77.100 77.100 77.100
Wageningen (M): 1 Chicken
chromosome 1
91.600 91.600 91.600


© The Roslin Institute 2007-2012, all rights reserved