This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005838


Marker Name:  MCW0107 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: GAACAGAACTCTGTTTACTG
Primer: TCTGCTTACCTCAACTGACA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003813
has an Associated Sequence: Sequence Genbank ID: L48906

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
565.000 565.000 565.000
Consensus 2005 (A): 1 Chicken
chromosome 1
564.000 565.000 566.000
East Lansing (M): 1 Chicken
chromosome 1
503.990 503.990 503.990
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
200846211.000 200846266.000 200846321.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
195120745.000 195120800.000 195120855.000
Ikeobi, C.O.N. et al . 2004 (A): 1 Chicken
chromosome 1
528.200 528.200 528.200
Jennen et al. 2004 (A): 1 Chicken
chromosome 1
565.000 565.000 565.000
Wageningen (A): 1 Chicken
chromosome 1
542.700 542.700 542.700
Wageningen (F): 1 Chicken
chromosome 1
537.100 537.100 537.100
Wageningen (M): 1 Chicken
chromosome 1
562.800 562.800 562.800


© The Roslin Institute 2007-2012, all rights reserved