This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005837


Marker Name:  MCW0106 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: GGCAACTAAGTTGTGGACTG
Primer: GCAGCATTCAGTGGGATAAT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L48902
has an Associated Sequence: Local Sequence ID: ARKFSQ00003812

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
53.390 53.390 53.390
Consensus 2000 (A): 1 Chicken
chromosome 1
94.000 94.000 94.000
Consensus 2005 (A): 1 Chicken
chromosome 1
93.000 94.000 95.000
East Lansing (M): 1 Chicken
chromosome 1
98.420 98.420 98.420
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
35456034.000 35456097.500 35456161.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
33555364.000 33555427.500 33555491.000
Tilquin et al. 2005 (A): 1 Chicken
chromosome 1
94.000 94.000 94.000
Wageningen (A): 1 Chicken
chromosome 1
67.000 67.000 67.000
Wageningen (F): 1 Chicken
chromosome 1
61.200 61.200 61.200
Wageningen (M): 1 Chicken
chromosome 1
73.000 73.000 73.000


© The Roslin Institute 2007-2012, all rights reserved