This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005832


Marker Name:  MCW0101 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: GTTTGTTTGCATCTGTAGTCTG
Primer: CCATATTCTGTTAGAAAGTAGAG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003808

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
254.560 254.560 254.560
Consensus 2000 (A): 1 Chicken
chromosome 1
248.000 248.000 248.000
Consensus 2005 (A): 1 Chicken
chromosome 1
247.000 248.000 249.000
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
81804631.000 81804766.000 81804901.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
78093654.000 78093792.000 78093930.000
Jennen et al. 2004 (A): 1 Chicken
chromosome 1
248.000 248.000 248.000
Jennen et al. 2005 (A): 1 Chicken
chromosome 1
122.200 122.200 122.200
Wageningen (A): 1 Chicken
chromosome 1
218.200 218.200 218.200
Wageningen (F): 1 Chicken
chromosome 1
205.100 205.100 205.100
Wageningen (M): 1 Chicken
chromosome 1
232.600 232.600 232.600


© The Roslin Institute 2007-2012, all rights reserved