This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005821


Marker Name:  MCW0090B 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 1353476

PCR Primers

Primer: GATCCTTCTTCCTCTCTCCTG
Primer: CCTTCAACTTAAAACATTATATGAG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
502.000 502.000 502.000


© The Roslin Institute 2007-2012, all rights reserved