This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005803


Marker Name:  MCW0068 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: CCTCACTGTGTAGTGTGGTAGTCA
Primer: GAGAAGCTTGAACCTACCAGTCTT
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
297.050 297.050 297.050
Consensus 2000 (A): 1 Chicken
chromosome 1
283.000 283.000 283.000
Consensus 2005 (A): 1 Chicken
chromosome 1
282.000 283.000 284.000
East Lansing (M): 1 Chicken
chromosome 1
260.100 260.100 260.100
Kerje et al. 2003a (A): 1 Chicken
chromosome 1
233.000 233.000 233.000
Kerje, S et al. 2003 (A): 1 Chicken
chromosome 1
233.000 233.000 233.000
Tilquin et al. 2005 (A): 1 Chicken
chromosome 1
283.000 283.000 283.000
Wageningen (A): 1 Chicken
chromosome 1
255.800 255.800 255.800
Wageningen (F): 1 Chicken
chromosome 1
246.100 246.100 246.100
Wageningen (M): 1 Chicken
chromosome 1
268.400 268.400 268.400
Wardecka et al. 2002 (F): 1 Chicken
chromosome 1
142.200 142.200 142.200


© The Roslin Institute 2007-2012, all rights reserved