This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005794


Marker Name:  MCW0058 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: GGGCACACAGAGTGGACACCA
Primer: TAGCATTTTCTCCAATGACTCCGG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
260.540 260.540 260.540
Consensus 2000 (A): 1 Chicken
chromosome 1
241.000 241.000 241.000
Consensus 2005 (A): 1 Chicken
chromosome 1
240.000 241.000 242.000
East Lansing (M): 1 Chicken
chromosome 1
211.160 211.160 211.160
Jacobsson et al 2004 (A): 1 Chicken
chromosome 1
200.600 200.600 200.600
Jennen et al. 2004 (A): 1 Chicken
chromosome 1
241.000 241.000 241.000
Jennen et al. 2005 (A): 1 Chicken
chromosome 1
114.600 114.600 114.600
Tilquin et al. 2005 (A): 1 Chicken
chromosome 1
241.000 241.000 241.000
Wageningen (A): 1 Chicken
chromosome 1
209.600 209.600 209.600
Wageningen (F): 1 Chicken
chromosome 1
199.300 199.300 199.300
Wageningen (M): 1 Chicken
chromosome 1
218.600 218.600 218.600


© The Roslin Institute 2007-2012, all rights reserved