This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005791


Marker Name:  MCW0055 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: TTTGTAGTTACCTGGTACTGA
Primer: GTTTGCATTGTCTACAGCTCCTTG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003782
has an Associated Sequence: Sequence Genbank ID: G31940

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL53 WASHUC2 Chicken Assembly: Z Chicken
chromosome Z
17805556.000 17805652.500 17805749.000
ENSEMBL71 Galgal4 Chick Assembly: Z Chicken
chromosome Z
18303924.000 18304020.500 18304117.000
Kerje, S et al. 2003 (A): Z Chicken
chromosome Z
0.000 0.000 0.000
Wageningen (A): Z Chicken
chromosome Z
30.000 30.000 30.000
Wageningen (M): Z Chicken
chromosome Z
30.000 30.000 30.000


© The Roslin Institute 2007-2012, all rights reserved